A) First PCR (ITS1-ITS4 primer pair) from different ocular samples. M,... | Download Scientific Diagram
a. Amplified rDNA ITS region with ITS1 and ITS4 primers of wild (Lanes... | Download Scientific Diagram
Location of the primers ITS1 ext B and ITS4 ext A used for... | Download Scientific Diagram
Illustration of positions of universal primers (ITS1 and ITS4) and... | Download Scientific Diagram
PCR products amplified with ITS1-ITS4 primers from six strains of... | Download Scientific Diagram
choice of fungal primers - General Discussion - QIIME 2 Forum
Universal Sequence Primer TGAATCATCGACTCTTTGAACGC Forward (ITS1)... | Download Scientific Diagram
PCR using primers ITS1 and ITS4. Lanes: 1, primers alone; 2, human DNA;... | Download Scientific Diagram
of primers used. ITS4 and ITS5 are standard primers for amplifying the... | Download Scientific Diagram
Structure of the rDNA gene in fungi indicating the two regions that... | Download Scientific Diagram
Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR | Journal of Clinical Microbiology
Conserved primer sequences for PCR amplification of fungal rDNA | Vilgalys Mycology Lab - Duke University
Fungal Identification Using Molecular Tools: A Primer for the Natural Products Research Community | Journal of Natural Products
Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts | BMC Microbiology | Full Text
High-Coverage ITS Primers for the DNA-Based Identification of Ascomycetes and Basidiomycetes in Environmental Samples | PLOS ONE
Oomycete-specific ITS primers for identification and metabarcoding
PCR amplification using primer pair ITS1 and ITS4 showing amplification... | Download Scientific Diagram
PCR-amplified products using ITS1 and ITS4 primers on Erysiphe (Sect.... | Download Scientific Diagram
Molecular variation analysis of Aspergillus flavus using polymerase chain reaction-restriction fragment length polymorphism of the internal transcribed spacer rDNA region
PCR amplification of DNA with primers ITS1, ITS4 (first primer pair)... | Download Scientific Diagram
ITS as an environmental DNA barcode for fungi: an in silico approach reveals potential PCR biases | BMC Microbiology | Full Text
Sizes of ITS1-ITS4 PCR products for Candida species before and after... | Download Table
Selection and Experimental Evaluation of Universal Primers to Study the Fungal Microbiome of Higher Plants | Phytobiomes Journal
